Did you know?
WebA range of conventional agarose-gel-based polymerase chain reaction (PCR) assays (Ireland and Binepal, 1998; Heine et al., 1999; Markoulatos et al., 2000; Tuppurainen et al., 2005; … WebApr 26, 2024 · For amplification of the 192-bp fragment of LSDV, a forward primer 5′-d TTTCCTGATTTTTCTTACTAT3′ and a reverse primer 5′-d AAATTATATACGTAAATAAC 3′ were used (Ireland and Binepal 1998). PCR reactions were carried out as an initial cycle at 94 °C for 1 min, 50 °C for 30 s, and 72 °C for 1 min, followed by 40 cycles of 94°C for 1 min …
WebNov 21, 2005 · DC Ireland YS Binepal (1998) ArticleTitle Improved detection of capripoxvirus in biopsy samples by PCR. J Virol Methods 74 1–7 Occurrence Handle 10.1016/S0166-0934(98)00035-4 Occurrence Handle 1:CAS:528:DyaK1cXltFWqsbo%3D Occurrence Handle … WebHadeer et al., J. of Virol.Sci., Vol.7: 41- 53, 2024 ISSN: 1685-1687 RESEARCH Correspondence: [email protected] Full list of author information is available at the end of the article
WebA fast and simple method for capripoxvirus species identification has been developed. The method is based on multiplex polymerase chain reaction (MPCR) with species-specific primers and does not require nucleotide sequencing or restriction analysis of PCR products. To differentiate vaccine strains used in Russia and countries of the former Soviet Union … WebJul 11, 2013 · Several PCR methods have been developed for the detection of CaPVs (Ireland and Binepal, 1998;Heine et al., 1999;Mangana-Vougiouka et al., 1999Markoulatos …
WebMar 1, 2016 · Ireland, Binepal, 1998 D.C. Ireland, Y.S. Binepal Improved detection of capripoxvirus in biopsy samples by PCR Journal of Virological Methods, 74 ( 1998), pp. 1 - …
Webimmunoassays ( Ireland and Binepal, 1998). In Egypt, LSDV was first isolated and identified from cattle during two outbreaks in Suez and Ismalia governorates on 1989 ( House et al., … greenock town hall phone numberWebIreland, D. C. & Y. S. Binepal, 1998. Im- proved detection of capripoxvirus in bi- opsy samples by PCR. Journal of Vi- rological Methods, 74, 1–7. Lamien, C. E., C. Le Goff, R. Silber, D. B. Wallace, V. Gulyaz, E.Tuppurainen, H. Madani, P. Caufour, T. Adam, M. El Har- rak, A. G. Luckins, E. Albina & A. Diallo, 2011a. fly me to the moon backing track guitarWebJul 30, 1999 · Recently, a PCR assay based on capripoxvirus fusion and attachment protein genes has been described for the detection of capripoxvirus in biopsy and tissue culture and shown to be more sensitive than antigen trapping ELISA (Ireland and Binepal, 1998). A PCR test for SPV detection has also been described by Mangana-Vougiouka et al. (1999). fly me to the moon auf deutschWebJan 1, 2006 · Several PCR methods have been developed for the detection of CaPVs (Ireland and Binepal, 1998;Heine et al., 1999;Mangana-Vougiouka et al., 1999Markoulatos et al., … fly me to the moon bass tab dmWeb472 Ebrahimi-Jam et al / Archives of Razi Institute, Vol. 76, No. 3 (2024) 471-485 1. Introduction The capripoxvirus genus, a member of the greenock town hall parkingWebDec 10, 2024 · The overall morbidity of LSD was 4.48% among 30 dairy farms. Skin nodular biopsy, whole blood and serum samples (n= 66) were collected for the diagnosis of LSD by histopathology, PCR and sequencing. The envelope protein gene (P32), Fusion protein (F) and DNA dependent RNA polymerase 30 kDa subunit (RPO30) genes were targeted for … fly me to the moon bayonetta ostWebApr 22, 2024 · Ireland DC, Binepal YS (1998) Improved detection of Capripoxvirus in biopsy samples by PCR. J Virol Methods 74:1–7. Article CAS Google Scholar Kumar S, Stecher G, … fly me to the moon bayonetta